mlst.net | Ssuis.mlst.net
 
DATA ANALYSIS
DATABASES
B.burgdorferi
B.cereus
B.henselae
B.pseudomallei
C.albicans
C.glabrata
C.krusei
C.tropicalis
C.jejuni
C.neoformans var grubii
E.coli
E.faecalis
E.faecium
H.influenzae
H.pylori
Leptospira spp.
M.catarrhalis
N.meningitidis
S.agalactiae
S.aureus
S.dysgalactiae
S.enterica
S.epidermidis
S.pneumoniae
S.pyogenes
S.suis
V.vulnificus
SUBMISSIONS
NEWS
LINKS
 

Primers and PCR conditions for MLST of S.suis

Internal fragments of the 5-enolpyruvylshikimate 3-phosphate synthase (aroA), 60 KDa chaperonin (cpn60), peroxide resistance (dpr), glucose kinase (gki), DNA mismatch repair protein (mutS), homologous recombination factor (recA) and aspartokinase (thrA) genes were amplified by PCR using the following primer pairs.

aroA-up 5’ TTCCATGTGCTTGAGTCGCTA 3’ and
aroA-dn 5’ ACGTGACCTACCTCCGTTGAC 3’

cpn-up 5’ TTGAAAAACGTRACKGCAGGTGC 3’and
cpn-dn 5’ ACGTTGAAIGTACCACGAATC 3’

dpr-up 5’ CGTCTTTCAGCCCGCGTCCA 3’ and
dpr-dn 5’ GACCAAGTTCTGCCTGCAGC 3’

gki-up 5’ GGAGCCTATAACCTCAACTGG 3’ and
gki-dn 5’ AAGAACGATGTAGGCAGGATT 3’

mutS-up 5’ CGCAGAGCAGATGGAAGATCC 3’ and
mutS-dn 5’ CCCATAGCTGTTTTGGTTTCATC 3’

recA-up 5’ TATGATGAGTCAGGCCATG 3’ and
recA-dn 5’ CGCTTAGCATTTTCAGAACC 3’

thrA-up 5’ GATTCAGAACGTCGCTTTGT 3’ and
thrA-dn 5’ AAGTTTTCATAGAGGTCAGC 3’

The primer 5’ AAGAATGGATCATCAACCGT 3’ was used for the forward thrA sequencing reaction

PCR reactions are performed in 50µl volumes using 30 cycles of 95oC for 1 min., XoC for 1 min. (where X is 55oC for aroA and gki, 52oC for cpn and thrA, and 50oC for dpr, mutS and recA) and 72oC for 1 min. PCR products are purified through Qiagen PCR purification kits and the sequence of each fragment is obtained on both strands using the same primers as those used in the initial PCR with the exception of thrA as described above.

The development of the initial Streptococcus suis MLST database is described in the following publication:

King, S.J., Leigh, J.A., Heath, P.J., Luque, I., Tarradas, C., Dowson, C.G., and Whatmore, A.M. 2002. Development of a multilocus sequence typing scheme for Streptococcus suis: Identification of virulent clones and potential capsular serotype exchange. J. Clin. Microbiol. 40:3671-3680.

The Streptococcus suis MLST database was developed by Sam King and Adrian Whatmore at the University of Warwick. We gratefully acknowledge the many co-workers who contributed strains for the pilot study (A. Cheng, B. Francois, M. Gottschalk, G. Grise, P. Heath, C. Lammler, I. Luque and P. Norton) and the financial support of the BBSRC (Grant 88/S11598) and The Wellcome Trust (Grant 053589).

 


 
Profile Query

 
Locus Query

Batch Query